Ube2i^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACTCAGAAACTCAATAGCAG and GGGCTTGTGAAAAACACTGT, which resulted in a 954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000207073 (exon 5) and 844 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 10 amino acids later. (J:188991)