This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCCTATCCATGCCTAG, GGTCCCGAGAGTGTTTACAG, GCACCTACAATACACTACAG and GCAACATACAGTACACTGCA, which resulted in a 580 bp deletion beginning at Chromosome 12 positive strand position 104,343,940 bp and ending after 104,344,519 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256671 (exon 4) and 426 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 22 bp deletion 21 bp after the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 304 and early truncation 41 amino acids later. (J:188991)