This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGGAGCTAGCCAGACTG, CTCCATCTCTGTGATATACT, CCTCAAAGACTCACGTACAG and GGGCCGTGTACGCATACCTT, which resulted in a 636 bp deletion beginning at Chromosome 9 positive strand position 27,317,073 bp and ending after 27,317,708 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967991 (exon 4) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 2 amino acids later. (J:188991)