This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTACCATGAGCCAAACCC, AACGTGAATGAGGACTTCCT, GAGATAATCCTATACTCATG and ATCTCTATCAGGCCAAAGCA, which resulted in a 355 bp deletion beginning at Chromosome 8 positive strand position 77,555,474 bp and ending after 77,555,828 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001258787 (exon 2) and 206 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 4 amino acids later. (J:188991)