This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTTACAAAGAGCAGGCCAC, GATTGCAGTGGCCTGAAGGC, GCTGCTGAGTCATATGTAGC and GCAGACTCCCATGACCATCA, which resulted in a 456 bp deletion beginning at Chromosome 10 negative strand position 94,295,355 bp and ending after 94,294,900 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000444933 (exon 2) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 8 amino acids later. (J:188991)