This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTCATTAGAAAAGTGCAG, TGAGCTGGTCAACATAACTG, ACCACTAATTACATCTCACA and CTCCTCATCATACACAACGC, which resulted in a 580 bp deletion beginning at Chromosome 4 negative strand position 96,769,948 bp and ending after 96,769,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000672016 (exon 2) and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 13 bp insertion (CAAACTCACTGAT) at the deletion site and a 3 bp deletion (TTG) 5 bp after the exon deletion that are not predicted to affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 31 amino acids later. (J:188991)