This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGGGTAGAAACAGCTGCA, GGATGAATAGTCCCAACTGT, GCAGGGAAGAAGCAACATAG and GCCTGACTTCCATCATGCAG, which resulted in a 464 bp deletion beginning at Chromosome 1 negative strand position 135,980,217 bp and ending after 135,979,754 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000820624 (exon 7) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 200 and early truncation 32 amino acids later. (J:188991)