Gpr150^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTAGAAGGCACTTTCAC, CAGGGCGGCGGTCTGGGGCG, TTCAGAATTGCGAGGCTGAA and ATGCGGGATTCAGAATTGCG, which resulted in a 1267 bp deletion beginning at Chromosome 13 negative strand position 76,056,814 bp and ending after 76,055,548 bp (GRCm38/mm10). This mutation causes an internal deletion of ENSMUSE00000362291 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and stop 4 amino acids later. (J:188991)