This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATGCTCACCGAGGTTTGA, ATCGAGCTTATGCGGAGAAA, ATCGGAGAAATCCCTGACGC and GGAGAAATCCCTGACGCTGG, which resulted in an internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 with read through the stop to generate a later stop 54 amino acids later. (J:188991)