This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAAGAGGAAGACCGACGC, AGACCGACGCCGGACAGCTG, GGCGGATGTGCCCGCGGGCA and TGGCAGGCGGATGTGCCCGC, which resulted in a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10). This mutation deletes 311 bp of ENSMUSE00001284940 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 1 amino acid later. (J:188991)