This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGTCCCTGTCCCTCTCACG, CATAGTCTGGGGCTACTGGG, GGGAACACTGAGTTGGCATA and CTAGAAGCCACATCCCTGAG, which resulted in a 1029 bp deletion beginning at Chromosome 4 positive strand position 152,279,522 bp and ending after 152,280,550 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000398729 (exon 3) and 599 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 1 amino acids later. (J:188991)