Hspb9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGCGGGTGCGAAGAGGAA, CGGGGCGGGTGCGAAGAGGA, TCGTTTTGTAAGGAGCTCTT and CCAGTCCCAGAAACCCAGGA, which resulted in a 296 bp deletion beginning at Chromosome 11 positive strand position 100,713,863 bp and ending after 100,714,158 bp (GRCm38/mm10). This mutation generates an internal deletion in ENSMUSE00000891702 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 18 amino acids later. (J:188991)