This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTGGGAACTATTACTGGG, CTCAGTTTAACTTTTCCAGG, GGTTACAGAGGGTTAACTGA and GCAGCTAATACATCATTAAA, which resulted in a total of 611 bp deletion beginning at Chromosome 9 positive strand position 65,999,223 bp for 48 bp where there is an endogenous 3 bp retention (GGA) followed by 563 bp deletion ending after 65,999,836 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221266 (exon 6) and 459 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 29 amino acids later. (J:188991)