This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAGTGATCGCCTCTTCCCAA, GGAAGAGGCGATCACTATGA, CACTAATTAGTCCAAGCGCA and TTTCCCACTGTAGATGATGT, which resulted in a 344 bp deletion beginning at Chromosome 2 negative strand position 73,318,471 bp and ending after 73,318,128 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271539 (exon 3) and 162 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 3 amino acids later. (J:188991)