This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTACTGGATAAAATTGGCC, CATTTGTTGTTAGTTCAGCT, GCAAAGGCCAGCATTAGGGT and GGTAGGGAAGACTCTGCCCT, which resulted in a 215 bp deletion beginning at Chromosome 11 positive strand position 70,972,871 bp and ending after 70,973,085 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001257298 (exon 3) and 154 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are a couple of indels including an 11 bp insertion (CTGCTCAGAGA) at the deletion site, and a 4 bp insertion (TCAG) and 15 bp deletion (CTAATGCTGGCCTTT) 31 bp after the exon deletion. These indels will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 84 and early truncation 4 amino acids later. (J:188991)