This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGTATAGGAGAAACAAG, TTCTCCTATACTGTGGTGAG, GACTCCTTAAATTGTCAGGG and GCCCCCAGAGAGTATATGTT, which resulted in a 239 bp deletion beginning at Chromosome 11 positive strand position 106,069,452 bp and ending after 106,069,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108225 (exon 2) and 132 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 8 amino acids later. (J:188991)