This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTTAAAGTGGCTGACAAA, GGAGTTAGCTTCTGCTAACT, ATAGACTCAGGCTAGGTGGG and AAAGCACTCTAGGCCAAGGG, which resulted in a 406 bp deletion beginning at Chromosome 11 positive strand position 97,030,797 bp and ending after 97,031,202 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001223462 (exon 3) and 224 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 45 amino acids later. (J:188991)