Cdk18^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCACAGCAGTAAATTTAGCA, CACCAGTTTGAGCCCCCCAG, CTAGCTGACATTGGGAAGAA and GACATGCCACTCAGTCTTGT, which resulted in a 226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000159061 (exon 3) and 146 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 42 and early truncation 87 amino acids later. (J:188991)