This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTAAAGCATCCACCAAATTG, GGGTCATATCAGTTAAAGAT, ATTCATACTCCTCAGAAGGC and GGACTGTTGTAAGTCATTAC, which resulted in a 420 bp deletion beginning at Chromosome 13 negative strand position 61,002,673 bp and ending after 61,002,254 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117869 (exon 6) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 12 amino acids later. (J:188991)