This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGTTGTACATTCCGAT, GAGAGTGGTCAGAGCTGTGA, GGTTTAATGCTGAGAAACGA and GCACTCGGAATGTGTTTGCA, which resulted in a 982 bp deletion beginning at Chromosome 16 positive strand position 43,943,264 bp and ending after 43,944,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000713202 (exon 9) and 521 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after residue 443. (J:188991)