This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGCGGGTTGCGGGCGGCTGC, TTTAATATCTTGGTGCTGCGand GCGGTAGGATAAGATGGTAG, which resulted in a 432 bp deletion beginning at Chromosome 14 positive strand position 57,798,370 bp and ending after 57,798,801 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000122492 (exon 2) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 9 amino acids later. (J:188991)