This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCTGCTGATTTTAAATCAGT, CTGCATGAAACTGTAAGATA and GAGAACACTAAATTTATGGG, which resulted in a 176 bp deletion beginning at Chromosome 16 positive strand position 20,152,865 bp, and ending after 20,153,040 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001279853 (exon 3) and 78 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp intronic deletion 48 bp after the 176 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 2 amino acids later. (J:188991)