This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACCTTCTACTACCATGA, GGGAGTTCCAGAGAACACTC, CTTGGCCTCCCAGAGACTAT and GCAATGGACCCACATACTAT, which resulted in a 474 bp deletion beginning at Chromosome 9 negative strand position 40,317,723 bp and ending after 40,317,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256460 (exon 5) and 389 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp insertion (GGTAGTAGAA) at the deletion site that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 229 and early truncation 35 amino acids later. (J:188991)