This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAACGACCTGCAGCTCAGGT, TCTATAGCATGAATATCTGT, GTAGAGTCTATACCACTAAG and CTTGGCATACTAACTGCAGT, which resulted in a 437 bp deletion beginning at Chromosome 4 negative strand position 41,229,880 bp, and ending after 41,229,444 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001205355 (exon 5) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 221 amino acids later. (J:188991)