This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTAAAATTAAAGAACCAAA, ATATTTAGGGATATCCCACAand GTATTTGTTATAAGGCCAGC, which resulted in a 346 bp deletion beginning at Chromosome 13 negative strand position 30,935,755 bp ATTTGTTATAAGGCCAGCAG, and ending after CATATTTAGGGATATCCCAC at 30,935,410 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000117295 (exon 4) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 98 and early truncation 8 amino acids later. (J:188991)