This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences CCAAAACAGCTTGTGAGACG, GAAGAAACGCTTGTGCATGG and ACAGCATATCCTATAGCCAC, which resulted in a 236 bp deletion beginning at Chromosome 8 positive strand position 106,898,379 bp, GCATGGGGGTATTAGTTCTG, and ending after GGACAGGATATTTTCCTGTG at 106,898,614 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517277 (exon 4) and 151 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 35 bp intronic deletion (TTCCCCGTCTCACAAGCTGTTTTGGTTTGTTTTGA, 8:106,898,306- 106,898,340) 38 bp before the 236 bp deletion that will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 17 amino acids later. (J:188991)