Stk35^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACCGTCTCGAATTGAACGG, GGAACCACCGGGAAGTACCG, TGTTAGGGAATGTCAGCTAA and GGATGAAGAGTAGTCCTGGT, which resulted in a 1047 bp deletion beginning at Chromosome 2 positive strand position 129,801,227 bp TACTTCCCGGTGGTTCCGTC, and ending after AGATGGATGAAGAGTAGTCC at 129,802,273 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001092478 (exon 2) and 446 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 63 amino acids later. (J:188991)