This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TGTATTCTGGATTTACCCGT, AGTTTTTTGCTATAAACCAT, GAATCATTTAAGGCCTGCCG, which resulted in a 294 bp deletion beginning at Chromosome 12 negative strand position 21,398,513 bp, GCCTGCCGGGGAAGCTAGTA, and ending after TAAGTATATTTGACCCACGG at 21,398,220 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001290283 (exon 2) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an additional 2 bp intronic deletion (CC) 19 bp before the 294 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 98 and early truncation 2 amino acids later. (J:188991)