Rab10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATAAACTGTTTAGATTGTTG, ATAAGCTCCACACTTCATAG, GCTGAGCTCAAACTTTAGGA, which resulted in a 452 bp deletion beginning at Chromosome 12 positive strand position 3,256,825 bp, ATTGTTGAGGGAGAGAGGGC, and ending after ATAAGCTCCACACTTCATAG at 3,257,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462111 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 11 amino acids later. (J:188991)