This allele from project Ccdc85b-8691J-5050M was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCCTCAGTCATCAGGGGAGC and GGAGGCCGAAGCAGGCGGCC, which resulted in a 680 bp deletion beginning at Chromosome 19 negative strand position 5,457,391 bp, GCCGAAGCAGGCGGCCTGGA, and ending after GCTGTGGACCTCCAGACCTG at 5,456,712 bp (GRCm38/mm10). This mutation deletes all of exon ENSMUSE00001034635 except the first 6 bp and an additional 77 bp of flanking intronic sequence and is predicted to cause early truncation after 2 amino acids. (J:188991)