This allele from project Trp53i11-8646J-9616F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGGCCCCCAGGTGTCCAC, GAGAGGTTGAGCTTGCATTG, GTAGGACCTTACACATACCC and CTGTGCAACCCAAACAGCCA, which resulted in a 235 bp deletion beginning at Chromosome 2 positive strand position 93,198,127 bp, TTGGGGAAAACATTTATGTT, and ending after GGATGGTTTTGTGTCCCGGG at 93,198,361 bp (GRCm38/mm10). This mutation deletes exon 4 and 176 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 21 amino acids later. (J:188991)