This allele from project Zscan5b-8665J-4435M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGTTTATGTGGGATAAT, TATGAATGTTCCCACAACTC, GCCAACACCAGAGTTGAGTT and TACCCTTGTCTGACACTCTT, which resulted in a 370 bp deletion beginning at Chromosome 7 positive strand position 6,233,707 bp, CTCTGGAAAAAAGTGAGTGT, and ending after CCAGAGTTGAGTTTGGACAA at 6,234,076 bp (GRCm38/mm10). This mutation deletes exon 5 and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 187 and early truncation 5 amino acids later. (J:188991)