Zfp940^em1(IMPC)J

This allele from project Zfp940-8675J-5908M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTATTCTCTCTCATAACCG, TGCTGCTGCACGAACATTCA, AGGATACACCAAAATATCGG and AGAGCTGGTAGTCTGGAGTA, which resulted in a 478 bp deletion beginning at Chromosome 7 negative strand position 29,847,106 bp, TCCATGTCGCTTCCTGCCCT, and ending after CTCTCATAACCGAGGAACCA at 29,846,629 bp (GRCm38/mm10). This mutation deletes exon 3 and 351 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 40 amino acids later. (J:188991)