Dgkb^em1(IMPC)J

This allele from project Dgkb-8572J-5198M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAGATGTTTCTATCTCCA, AAGATGAAGCCAAGGCTTAG, ATGTCTCTAGCAAAATAAGT and GGATACTGGATACTCTATAA, which resulted in a 566 bp deletion beginning at Chromosome 12 positive strand position 38,100,137 bp, GGAGATAGAAACATCTAACT, and ending after AGTAGGGTAGAAAATAGTAT at 38,100,702 bp (GRCm38/mm10). This mutation deletes exon 4 and 412 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 3 amino acids later. (J:188991)