This allele from project Nt5dc2-8541J-1639M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCAGTGTCCTAGTTGAG, ATACTTAGTCAAGGGCCCCT, GGCTAGAGCCAACGGCACCA and GGTCGGCCCTGGACTGTGCA, which resulted in a 321 bp deletion beginning at Chromosome 14 positive strand position 31,136,450 bp, CAGGGGCCCTTGACTAAGTA, and ending after GGGGCTAGAGCCAACGGCAC at 31,136,770 bp (GRCm38/mm10). This mutation deletes exon 9 and 239 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 179 and early truncation 8 amino acids later. (J:188991)