This allele from project Hmg20a-8517J-1759F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTATGTAAGTTCAGCA, GAAGGTAGCATATAAAAGCC, GCCCTGCTGAACATTATAGG and ACTGCGGCTTCCAAAGCAAT, which resulted in a 788 bp deletion beginning at Chromosome 9 positive strand position 56,474,209 bp CTGGTCCATTACTAGGGTTT, and ending after GCTGTTTTGATATAGGGTCT at 56,474,996 bp (GRCm38/mm10). This mutation deletes exon 3 and 643 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 34 amino acids later. (J:188991)