This allele from project Larp1b-8531J-915F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATAACCTCCAGATCACACG, CAGTAGTCCTCTGACACGAT, ATATTTTCTCAATATCCTAG and AATGTCATTGCCTAATGAGA, which resulted in a 528 bp deletion beginning at Chromosome 3 positive strand position 40,970,239 bp GTGATCTGGAGGTTATATGC, and ending after AAATGTCATTGCCTAATGAG at 40,970,766 bp (GRCm38/mm10). In addition there is a 9 bp insertion (ATGAAAAAA) at the deletion site that will not alter the results of the exon deletion. This mutation deletes exon 7 and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 28 amino acids later. (J:188991)