This allele from project Mylk4-8533J-952F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATATACTTCTGGTTTAACAT, AGGCTCCCTGATTTTACTGA, TTACTTGGTGCAGAAAGGAG and GCGAGAAATCTGAAGTTCCA, which resulted in a 584 bp deletion beginning at Chromosome 13 negative strand position 32,725,161 bp, GAACTTCAGATTTCTCGCTG, and ending after ATACTTCTGGTTTAACATTG at 32,724,578 bp (GRCm38/mm10). This mutation deletes exon 3 and 478 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 16 amino acids later. (J:188991)