Aacs^em1(IMPC)J

This allele from project Aacs-8504J-0112F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGTCACGTGCCATGGACT, CTCTTCAGCCGAGCCTCAAA, TCCTCAAGCAACATTTCACT and ATTTCACTCGGAAACAATCA, which resulted in a 256 bp deletion beginning at Chromosome 5 positive strand position 125,482,732 bp, ATTTCACTCGGAAACAATCA, and ending after GGATGTCACGTGCCATGGAC at 125,482,987 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 51 amino acids later. (J:188991)