This allele from project Prkag2-8317J-M9745 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTACCTGCTCTAGTCCTCCG, TTGATGCTATGGTTTCAGGT, GCTGTCTAACAGAGCCTCAA and GCATTCCCTTGTCACCTCTG, which resulted in a 686 bp deletion beginning at Chromosome 5 negative strand position 25,022,291 bp AGGCTCTGTTAGACAGCTCC, and ending after TGCTCTAGTCCTCCGGGGTG at 25,021,606 bp (GRCm38/mm10). This mutation deletes exon 3 and 406 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 13 amino acids later. (J:188991)