This allele from project Zfp827-8389J-M1094 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGGTCCAACAGTTCCA, TCAGTCCATGTCCATCTTTT, GCAAGCCTGACGACCGCACA and GGTCTGTGCTCTAAACTCTA, which resulted in a 289 bp deletion beginning at Chromosome 8 positive strand position 79,120,356 bp TTCCATGGATGTTATCTGGA, and ending after TCTAAACTCTATGGATTCAG at 79,120,644 bp (GRCm38/mm10). This mutation deletes exon 7 and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 737 and early truncation 100 amino acids later. (J:188991)