This allele from project Lpgat1-8352J-F7972 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAACTTAGATGTTTACCAAC, ATTTTTCTAAGTTTGAAACT, CCTCGGGAGGATATCCTGCA and GTCTTAAAATTCCCTTCCTG, which resulted in a 585 bp deletion beginning at Chromosome 1 positive strand position 191,749,206 bp TGAATTCTTTCCCATGATAT, 15 bases later there is retention of 5 endogenous bp (TAAGT) in the intron, and ending after CAGGAAGGGAATTTTAAGAC at 191,749,795 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 79 and early truncation 48 amino acids later. (J:188991)