This allele from project Gramd3-8350J-M0605 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCCTTGCATAATCTCCGT, CTTTCTGCAGTTCATCACGA, GGTCAGCTGTGGAATCGAAT and TGCGACTCTATTATCGTGAG, which resulted in a 279 bp deletion beginning at Chromosome 18 positive strand position 56,474,000 bp GTGGGTTTTATTTCCCCAGG, and ending after ACTGTTCCTCCAGCCTATTC at 56,474,278 bp (GRCm38/mm10). This mutation deletes exon 3 and 167 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. (J:188991)