Tbc1d16^em1(IMPC)J

This allele from project Tbc1d16-8341J-M1322 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGGCTTAGGGCCACCACA, GCCTCACTACCCAGCCTGGT, TGGCTTGTCGTTCTAAATGG and AGAAAGCCATTGCTGACTGG, which resulted in a 958 bp deletion beginning at Chromosome 11 negative strand position 119,209,527 bp, GACTGGAGGAGACCCAAGTG, and ending after CAGCCTCACTACCCAGCCTG at 119,208,570 bp (GRCm38/mm10). This mutation deletes exon 3 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel 26 bp after the deletion (AGCCAAGA insertion/TTTAG deletion) that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 145 amino acids later. (J:188991)