This allele from project Mgme1-8310J-M0767 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGAAATTTTGTATCTAA, AGGGTGAAATTTTGTATCTA, GTGCCTCCTTCAGTCACTGT and GGTGGGCCAGGATTGTCTAT, which resulted in a 426 bp deletion beginning at Chromosome 2 positive strand position 144,276,173bp CTAAGGGTTTTCCATTTAAA, and ending after AATGGGTGGGCCAGGATTGT at 144,276,598 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 5 amino acids later. (J:188991)