This allele from project Cntnap5a-8274J-F2258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGACTATGAACCTACTA, ATTTCATGGATCTTTACCAC, TCTTACTGTAACCTGATTGT and ACTAATACTCTTATTCCCTT, which resulted in a 660 bp deletion beginning at Chromosome 1 positive strand position 115,914,854 bp, GTCCCCTAGTAGGTTCATAG and ending after GTAGCTCTATCCAAAGGGAA at 115,915,513 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 8 amino acids later. (J:188991)