This allele from project Zswim6-8179J-F8985 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACTTTATACTAACTGAGAG, TTGACTTTCGGCAGCATAGG, AGTGAAGTGCAGCTTACTGT and GAGGCTCTGCTCTTTTAACA, which resulted in a 555 bp deletion beginning at Chromosome 13 negative strand position 107,773,763 bp, TTAACATGGAAGTACTTGGG, and ending after TAATTGACTTTCGGCAGCAT at 107,773,209 bp (GRCm38/mm10). This mutation deletes exon 4 and 406 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 338 and early truncation 23 amino acids later. (J:188991)