Hmcn1^em1(IMPC)J

This allele from project Hmcn1-8315J-M9720 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCGTAATTCATTCTAGACAT, TGCTGAGTCTAGTCCTACAC, TAGCCAACAATTATATACTA and TATTTGAGTAATAGATCTTG, which resulted in a 436 bp deletion beginning at Chromosome 1 negative strand position 150,876,740 bp, TTGTGGCATTTCTGACTATG, and ending after TTTCTTTCCCCACCCATGTC at 150,876,305 bp (GRCm38/mm10). This mutation deletes exon 2 and 365 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 3 amino acids later. (J:188991)