Eef1b2^em1(IMPC)J

This allele from project Eef1b2-8293J-M9257 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTGTTTTGCCTAGAAA, TTAACCTTTAGCACAATCCC, GCCACGCCAGGATCCATCCA and CAAGCATATTGAGAAGCCTG, which resulted in a 329 bp deletion beginning at Chromosome 1 positive strand position 63,178,315 bp, CTGGGATTGTGCTAAAGGTT, and ending after CTCCCTGGATGGATCCTGGC at 63,178,643 bp (GRCm38/mm10). This mutation deletes exon 3 and 202 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 34 amino acids later. (J:188991)