Alg9^em1(IMPC)J

This allele from project Alg9-8257J-M6224 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCAGGAAGGTCCTGCTA, TTAGTGTGTACCTTAGAAGC, TCGCCTAAATTTGAGCTGCT and TTGATCTTGATTTGGTACTT, which resulted in a 484 bp deletion beginning at Chromosome 9 negative strand position 50,776,825 bp, GTACCAAATCAAGATCAAAG, and ending after CGTCCACTTCCTGCTTCTAA at 50,776,342 bp (GRCm38/mm10). This mutation deletes exon 2 and 348 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 46 and early truncation 51 amino acids later. (J:188991)